epsM [2019-04-04 15:05:57]

UDP-2,4,6-trideoxy-2-acetamido-4-amino glucose acetyltransferase, extracellular polysaccharide synthesis

Locus: BSU34240

Isoelectric point: 9.43

Molecular weight: 22.34 kDa

Protein length: 216 aa

Gene length: 651 bp

Function: Biofilm formation, biosynthesis of N,N'-diacetylbacillosamine

Product: UDP-2,4,6-trideoxy-2-acetamido-4-amino glucose acetyltransferase

Essential: no

Synonyms: yvfD

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Matrix polysaccharide synthesis

Gene

Coordinates: 3,516,233 3,516,883

Phenotypes of a mutant

• smooth colonies on MsGG medium, no biofilm formation PubMed

The protein

Catalyzed reaction/ biological activity

• conversion of UDP-2,4,6-trideoxy-2-acetamido-4-amino glucose to UDP-2,4,6-trideoxy-2,4-diacetamido glucose (N,N'-diacetylbacillosamine) PubMed

Protein family

• transferase hexapeptide repeat family (according to Swiss-Prot)

Cofactors

• coenzyme A PubMed

Structure

• 4M99 (from Neisseria gonorrhoeae, 38% identity) PubMed

Expression and Regulation

Operons

• Genes: epsA-epsB-epsC-epsD-epsE-epsF-epsG-epsH-epsI-epsJ-epsK-epsL-epsM-epsN-epsO
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • RemA: activation, PubMed, in RemA regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • SinR: anti-activation, (prevents binding of RemA) PubMed, in SinR regulon
  • EAR riboswitch: processive antitermination, in EAR riboswitch

  Regulation

  • repressed by SinR PubMed

  Additional information

  • induction by sequestration of SinR by SinI or SlrA PubMed
  • expression is increased in rsiX mutants PubMed

Biological materials

Mutant

• MGNA-B609 (yvfD::erm), available at the NBRP B. subtilis, Japan
• BKE34240 (epsM::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTCACCCACAATGGCCACAT, downstream forward: _UP4_CAAACATCAAACAAAGGATG
• BKK34240 (epsM::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTCACCCACAATGGCCACAT, downstream forward: _UP4_CAAACATCAAACAAAGGATG

Labs working on this gene/protein

• Richard Losick, Harvard Univ., Cambridge, USA homepage

References

Reviews

Loading

Research papers

Loading

The EAR RNA switch

Loading